Lesson 16 - Unit 4 - Quiz #4
1. Write the sequence of bases obtained if a given DNA strand replicates. 2. Write the sequence of bases on a messenger RNA molecule if a given DNA strand undergoes
transcription. 3. Write the sequence of amino acids obtained if a given messenger RNA molecule undergoes
translation. 4. Write the amino acid sequence obtained when a given DNA base sequence is altered
by a given, specific mutation.
Below is a sample examination covering these points: Suppose a strand of a DNA molecule has the following sequence of bases ATGCCCTACAGTGTAGCCTATGGCACTAAACTC (This is the "original DNA strand" referred to in the following questions)
a. What sequence of bases is produced if this DNA strand replicates? b. What sequence of bases is produced if the "original DNA strand" undergoes
transcription? c. What sequence of amino acids is produced in a protein if the messenger
RNA produced in step b undergoes translation on a ribosome? Use the Genetic Code dictionary.
d. What is the amino acid sequence if the 15th base in the "original DNA strand"
mutates from A to T? e. What is the amino acid sequence if the 15th base in the "original DNA strand"
is eliminated (a deletion mutation).
|