Skip Navigation Links
Skip Navigation Links
About
Admissions
Academics
Continuing ED
Alumni
Community
Donate
Skip Navigation LinksKCC Home > Academic Departments > Biological Sciences > 11New > Bio 11 Webpages > Unit 4, Lesson 16


Lesson 16 - Unit 4 - Quiz #4

1. Write the sequence of bases obtained if a given DNA strand replicates.
2. Write the sequence of bases on a messenger RNA molecule if a given DNA strand undergoes
    transcription.
3. Write the sequence of amino acids obtained if a given messenger RNA molecule undergoes
    translation.
4. Write the amino acid sequence obtained when a given DNA base sequence is altered by
    a given, specific mutation.

Below is a sample examination covering these points:
    Suppose a strand of a DNA molecule has the following sequence of bases
    ATGCCCTACAGTGTAGCCTATGGCACTAAACTC
    (This is the "original DNA strand" referred to in the following questions)

        a. What sequence of bases is produced if this DNA strand replicates?
        b. What sequence of bases is produced if the "original DNA strand" undergoes transcription?
        c. What sequence of amino acids is produced in a protein if the messenger RNA produced in step b
            undergoes translation on a ribosome? Use the Genetic Code dictionary.
        d. What is the amino acid sequence if the 15th base in the "original DNA strand" mutates from A to
            T?
        e. What is the amino acid sequence if the 15th base in the "original DNA strand" is eliminated (a
            deletion mutation).



       















kccFacebook KCCTwitter
Privacy Statement | GAINFUL EMPLOYMENT | Disclaimer | LIAISONS | Text Only | Make This Website Talk  

Kingsborough Community College
2001 Oriental Boulevard, Brooklyn, NY 11235-2398 | (718)-368-5000
Kingsborough is CUNY